fast semidry protein transfer machine Search Results


1260 infinity bio inert hplc fplc machine  (Agilent technologies)
95
Agilent technologies 1260 infinity bio inert hplc fplc machine
1260 Infinity Bio Inert Hplc Fplc Machine, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1260 infinity bio inert hplc fplc machine/product/Agilent technologies
Average 95 stars, based on 1 article reviews
1260 infinity bio inert hplc fplc machine - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier
fplc machine  (GE Healthcare)
94
GE Healthcare fplc machine
Fplc Machine, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fplc machine/product/GE Healthcare
Average 94 stars, based on 1 article reviews
fplc machine - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier
tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer  (Cell Signaling Technology Inc)
96
Cell Signaling Technology Inc tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Tgtagaccatgtagttgaggtca 7900 Ht Fast Real Time Pcr Machine 2 2 Sulf2 Protein Expression Analysis Protein Lysis Buffer, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
tgtagaccatgtagttgaggtca 7900 ht fast real time pcr machine 2 2 sulf2 protein expression analysis protein lysis buffer - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier
c1000 thermal cycler pcr machine bio rad  (Bio-Rad)
98
Bio-Rad c1000 thermal cycler pcr machine bio rad
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
C1000 Thermal Cycler Pcr Machine Bio Rad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/c1000 thermal cycler pcr machine bio rad/product/Bio-Rad
Average 98 stars, based on 1 article reviews
c1000 thermal cycler pcr machine bio rad - by Bioz Stars, 2026-06
98/100 stars
  Buy from Supplier
äkta prime plus fplc machines  (GE Healthcare)
96
GE Healthcare äkta prime plus fplc machines
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
äkta Prime Plus Fplc Machines, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/äkta prime plus fplc machines/product/GE Healthcare
Average 96 stars, based on 1 article reviews
äkta prime plus fplc machines - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier
electron microscope merlin compact  (Carl Zeiss)
90
Carl Zeiss electron microscope merlin compact
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Electron Microscope Merlin Compact, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/electron microscope merlin compact/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
electron microscope merlin compact - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
fast protein liquid chromatography fplc äkta start machine  (GE Healthcare)
96
GE Healthcare fast protein liquid chromatography fplc äkta start machine
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Fast Protein Liquid Chromatography Fplc äkta Start Machine, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fast protein liquid chromatography fplc äkta start machine/product/GE Healthcare
Average 96 stars, based on 1 article reviews
fast protein liquid chromatography fplc äkta start machine - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier
fast semidry protein transfer machine  (Bio-Rad)
99
Bio-Rad fast semidry protein transfer machine
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Fast Semidry Protein Transfer Machine, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fast semidry protein transfer machine/product/Bio-Rad
Average 99 stars, based on 1 article reviews
fast semidry protein transfer machine - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier
proteina proteinb  (PROTEINA Co Ltd)
90
PROTEINA Co Ltd proteina proteinb
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Proteina Proteinb, supplied by PROTEINA Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/proteina proteinb/product/PROTEINA Co Ltd
Average 90 stars, based on 1 article reviews
proteina proteinb - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
dimer proteina/protein  (PROTEINA Co Ltd)
90
PROTEINA Co Ltd dimer proteina/protein
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Dimer Proteina/Protein, supplied by PROTEINA Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dimer proteina/protein/product/PROTEINA Co Ltd
Average 90 stars, based on 1 article reviews
dimer proteina/protein - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
proteina-sbp fusion protein  (PROTEINA Co Ltd)
90
PROTEINA Co Ltd proteina-sbp fusion protein
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Proteina Sbp Fusion Protein, supplied by PROTEINA Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/proteina-sbp fusion protein/product/PROTEINA Co Ltd
Average 90 stars, based on 1 article reviews
proteina-sbp fusion protein - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
proteina protein-modified chips  (PROTEINA Co Ltd)
90
PROTEINA Co Ltd proteina protein-modified chips
There is an absence of <t>Sulf2</t> mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).
Proteina Protein Modified Chips, supplied by PROTEINA Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/proteina protein-modified chips/product/PROTEINA Co Ltd
Average 90 stars, based on 1 article reviews
proteina protein-modified chips - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


There is an absence of Sulf2 mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).

Journal: Methods in molecular biology (Clifton, N.J.)

Article Title: Measuring sulfatase expression and invasion in glioblastoma

doi: 10.1007/978-1-4939-1714-3_39

Figure Lengend Snippet: There is an absence of Sulf2 mRNA expression in NPC isolated from Sulf2−/− mice demonstrating the specificity of the primers for Sulf2 (A). Bars represent the mean +/− SEM of triplicate samples. For each sample the GAPDH Ct was subtracted from the Sulf2 Ct to generate a Delta Ct, this was averaged across technical triplicates, normalized to Sulf2 mRNA expression in Sulf2 wild type NPC (Sulf2+/+), and expressed as relative quantification [2^-(normalized DeltaCt). In (B) specificity of the 2B4 mouse anti-Sulf2 antibody is demonstrated by the decrease in full length 140kD and C-terminal fragment 50kD SULF2 (black arrows) in U251 cells which have shRNA knockdown of SULF2 (KD) compared to a scrambled shRNA control (Scr) U251 cells. Equivalent quantities of protein are demonstrated with the use of GAPDH as a loading control. A high molecular weight non-specific band is indicated by the white arrow. The shRNA construct has been reported previously (16) (see Note 10).

Article Snippet: Human GAPDH forward primer: CGACAGTCAGCCGCATCTT Human GAPDH reverse primer: CCGTTGACTCCGACCTTCA Mouse GAPDH forward primer: AGGTCGGTGTGAACGGATTTG Mouse GAPDH reverse primer: TGTAGACCATGTAGTTGAGGTCA 7900 HT Fast Real Time PCR machine 2.2 SULF2 protein expression analysis Protein lysis buffer: 1x of 10X Lysis buffer (Cell Signaling Technology, Boston, MA), 1x of 100x Protease Inhibitor Cocktail (Sigma Chemical Company, St. Louis, MO, USA), and 1x of 100X HaltTM Phosphatase Inhibitor Single-Use Cocktail (Thermo Fisher Scientific Inc, Waltham, MA) in milli-Q water.

Techniques: Expressing, Isolation, Quantitative Proteomics, shRNA, Knockdown, Control, High Molecular Weight, Construct